BBa_S05077 1 BBa_S05077 I712015:B0010 2012-09-21T11:00:00Z 2015-05-08T01:14:49Z false false _9_ 0 11584 9 Not in stock false false Juan Sim??n ??lamos component2193437 1 BBa_B0010 component2193436 1 BBa_I712015 annotation2193436 1 BBa_I712015 range2193436 1 1 42 annotation2193437 1 BBa_B0010 range2193437 1 43 122 BBa_I712015 1 BBa_I712015 HIV-1 protease cleavage site 2007-10-20T11:00:00Z 2015-08-31T04:07:46Z This is proteolytic cleavage site for HIV-1 protease. false false _130_ 0 1883 9 In stock false true Katja Kolar BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_S05077_sequence 1 agccaggtgagccagaactaccccatcgtgcagaacctccaaccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_I712015_sequence 1 agccaggtgagccagaactaccccatcgtgcagaacctccaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z