BBa_K1051405 1 BBa_K1051405 promoter->ftsQp no RBS 2013-07-10T11:00:00Z 2015-05-08T01:08:55Z E.coli genome It's an E.coli promoter which initiate the transcription of gene ftsA without RBS. ftsA is a protein which is a composition of E.coli flagellin. false false _1358_ 0 15947 9 In stock false It's used to initiate the specific FP. false Bingwei Zheng BBa_S05189 1 BBa_S05189 K1051404:B0030 2013-09-09T11:00:00Z 2015-05-08T01:14:51Z false false _9_ 0 15926 9 Not in stock false false Wei Wei component2337557 1 BBa_B0030 component2337555 1 BBa_K1051405 annotation2337557 1 BBa_B0030 range2337557 1 207 221 annotation2337555 1 BBa_K1051405 range2337555 1 1 198 BBa_B0030 1 BBa_B0030 RBS.1 (strong) -- modified from R. Weiss 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Strong RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0032</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _44_46_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;orig&quot; in figure 4-14 of Ron Weiss thesis). <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation7025 1 BBa_B0030 range7025 1 1 15 annotation1702 1 RBS range1702 1 8 12 annotation1701 1 RBS-1\Strong range1701 1 1 15 BBa_B0030_sequence 1 attaaagaggagaaa BBa_S05189_sequence 1 ccgcgaaggttccagtgtgggaatgtcaaaagtagtagcagaaaatgctctacaagatgcattaagattggcatttcagcacgatgaagaagtattgattgaaaaatggctaagtgggccggagttcacggttgcgatactcggtgaagaaattttaccgtcaatacgtattcaaccgtccggaaccttctatgattatactagagattaaagaggagaaa BBa_K1051405_sequence 1 ccgcgaaggttccagtgtgggaatgtcaaaagtagtagcagaaaatgctctacaagatgcattaagattggcatttcagcacgatgaagaagtattgattgaaaaatggctaagtgggccggagttcacggttgcgatactcggtgaagaaattttaccgtcaatacgtattcaaccgtccggaaccttctatgatta igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z