BBa_S05275 1 BBa_S05275 R0040:B0034 2015-08-25T11:00:00Z 2015-08-26T12:28:26Z false false _9_ 27305 27305 9 false false Barbara Steijl component2438303 1 BBa_B0034 component2438297 1 BBa_R0040 annotation2438303 1 BBa_B0034 range2438303 1 63 74 annotation2438297 1 BBa_R0040 range2438297 1 1 54 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_R0040 1 p(tetR) TetR repressible promoter 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z Lutz, R., Bujard, H., <em>Nucleic Acids Research</em> (1997) 25, 1203-1210. Released HQ 2013 Sequence for pTet inverting regulator driven by the TetR protein.</P> false true _1_ 0 24 7 In stock false <P> <P>BBa_R0040 TetR-Regulated Promoter is based on a cI promoter. It has been modified to include two TetR binding sites and the BioBrick standard assembly head and tail restriction sites.<P> true June Rhee, Connie Tao, Ty Thomson, Louis Waldman annotation1986785 1 -35 range1986785 1 20 25 annotation1986787 1 -10 range1986787 1 43 48 annotation1986783 1 TetR 1 range1986783 1 1 19 annotation1986784 1 BBa_R0040 range1986784 1 1 54 annotation1986786 1 TetR 2 range1986786 1 26 44 BBa_S05275_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcactactagagaaagaggagaaa BBa_B0034_sequence 1 aaagaggagaaa BBa_R0040_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z