BBa_S05277 1 BBa_S05277 S05276:B0034 2015-08-27T11:00:00Z 2015-08-28T03:50:09Z false false _9_ 27305 27305 9 false false Barbara Steijl component2439238 1 BBa_S05276 component2439236 1 BBa_B0034 component2439240 1 BBa_B0034 annotation2439240 1 BBa_B0034 range2439240 1 35 46 annotation2439236 1 BBa_B0034 range2439236 1 63 74 annotation2439238 1 BBa_S05276 range2439238 1 1 26 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_S05276 1 BBa_S05276 R0040:B0034 2015-08-27T11:00:00Z 2015-08-28T03:23:28Z false false _9_ 27305 27305 9 false false Barbara Steijl annotation2439171 1 BBa_R0040 range2439171 1 1 54 annotation2439172 1 TetR 1 range2439172 1 1 19 annotation2439175 1 -10 range2439175 1 43 48 annotation2439174 1 TetR 2 range2439174 1 26 44 annotation2439173 1 -35 range2439173 1 20 25 annotation2439176 1 conserved range2439176 1 67 70 annotation2439177 1 BBa_B0034 range2439177 1 63 74 BBa_B0034_sequence 1 aaagaggagaaa BBa_S05277_sequence 1 gatgtcaaagaatacaagcattgacttactagagaaagaggagaaa BBa_S05276_sequence 1 gatgtcaaagaatacaagcattgact igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z