BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916612 1 BBa_B0012 component1916610 1 BBa_B0010 annotation1916610 1 BBa_B0010 range1916610 1 1 80 annotation1916612 1 BBa_B0012 range1916612 1 89 129 BBa_S05281 1 BBa_S05281 K1620004:B0015 2015-09-02T11:00:00Z 2015-09-03T02:53:51Z false false _9_ 23597 23597 9 false false Celio Dias Santos Jr component2443268 1 BBa_B0015 component2443261 1 BBa_K1620004 annotation2443268 1 BBa_B0015 range2443268 1 528 656 annotation2443261 1 BBa_K1620004 range2443261 1 1 519 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 BBa_K1620004 1 Zur Zinc uptake regulation protein - Zur 2015-09-02T11:00:00Z 2015-09-13T03:57:27Z Designed from gene "zur" from E. coli K12 MG-1655 genome. Synthesized as G-block by IDT. PCR amplified using following primers: Fwd: 5' - GAA TTC GCG GCC GCT TCT AGA GAT GGA AAA GAC CAC AAC GCA - 3' Rev: 5' - TAC TAG TAG CGG CCG CTG CAG TTA ACG CGG TTT CTT TTT CA - 3' The assembly was made through 3A assembly method. Acts like a negative controlling element of promoter Zasp (BBa_K1620001) by use of Zn(II) as a cofactor to bind the operator of the repressed genes (znuACB). In our project it was used to regulate a kill switch based on zinc concentration to promote cellular death. false false _2037_ 23597 23597 9 false The designed gene was as provided by E. coli genome, with the same codon frequencies. false Celio Dias Santos Jr annotation2443232 1 Fwd range2443232 1 1 20 annotation2443233 1 Rev range2443233 1 499 519 annotation2443231 1 Zur range2443231 1 1 519 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_S05281_sequence 1 atggaaaagaccacaacgcaggagttattagcgcaggctgaaaaaatctgcgcgcagcgtaatgtgcgcctgaccccacagcgcctggaagtgttgcgcctgatgagtctgcaagatggcgctatcagcgcttatgatctgcttgatttactgcgcgaagctgaaccgcaagccaagccgccaacggtttatcgcgcgctggattttctgcttgagcaaggttttgtgcataaggtggaatccaccaacagttatgtgctctgtcatctgttcgatcagcccacccatacgtcagccatgtttatttgcgatcgctgcggcgcagtgaaagaagagtgtgcagaaggcgtggaagacattatgcatacgctggcggcaaaaatggggtttgccctgcggcataatgtgattgaagcacatgggctctgtgcggcatgtgtagaagtggaagcgtgtcgtcatcctgaacagtgccagcatgatcactctgtgcaggtgaaaaagaaaccgcgttaataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K1620004_sequence 1 atggaaaagaccacaacgcaggagttattagcgcaggctgaaaaaatctgcgcgcagcgtaatgtgcgcctgaccccacagcgcctggaagtgttgcgcctgatgagtctgcaagatggcgctatcagcgcttatgatctgcttgatttactgcgcgaagctgaaccgcaagccaagccgccaacggtttatcgcgcgctggattttctgcttgagcaaggttttgtgcataaggtggaatccaccaacagttatgtgctctgtcatctgttcgatcagcccacccatacgtcagccatgtttatttgcgatcgctgcggcgcagtgaaagaagagtgtgcagaaggcgtggaagacattatgcatacgctggcggcaaaaatggggtttgccctgcggcataatgtgattgaagcacatgggctctgtgcggcatgtgtagaagtggaagcgtgtcgtcatcctgaacagtgccagcatgatcactctgtgcaggtgaaaaagaaaccgcgttaataa BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z