BBa_B0030 1 BBa_B0030 RBS.1 (strong) -- modified from R. Weiss 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Strong RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0032</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _44_46_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;orig&quot; in figure 4-14 of Ron Weiss thesis). <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation1701 1 RBS-1\Strong range1701 1 1 15 annotation1702 1 RBS range1702 1 8 12 annotation7025 1 BBa_B0030 range7025 1 1 15 BBa_K1620004 1 Zur Zinc uptake regulation protein - Zur 2015-09-02T11:00:00Z 2015-09-13T03:57:27Z Designed from gene "zur" from E. coli K12 MG-1655 genome. Synthesized as G-block by IDT. PCR amplified using following primers: Fwd: 5' - GAA TTC GCG GCC GCT TCT AGA GAT GGA AAA GAC CAC AAC GCA - 3' Rev: 5' - TAC TAG TAG CGG CCG CTG CAG TTA ACG CGG TTT CTT TTT CA - 3' The assembly was made through 3A assembly method. Acts like a negative controlling element of promoter Zasp (BBa_K1620001) by use of Zn(II) as a cofactor to bind the operator of the repressed genes (znuACB). In our project it was used to regulate a kill switch based on zinc concentration to promote cellular death. false false _2037_ 23597 23597 9 false The designed gene was as provided by E. coli genome, with the same codon frequencies. false Celio Dias Santos Jr annotation2443231 1 Zur range2443231 1 1 519 annotation2443232 1 Fwd range2443232 1 1 20 annotation2443233 1 Rev range2443233 1 499 519 BBa_S05282 1 BBa_S05282 B0030:K1620004 2015-09-02T11:00:00Z 2015-09-03T03:01:35Z false false _9_ 23597 23597 9 false false Celio Dias Santos Jr component2443270 1 BBa_B0030 component2443275 1 BBa_K1620004 annotation2443270 1 BBa_B0030 range2443270 1 1 15 annotation2443275 1 BBa_K1620004 range2443275 1 22 540 BBa_B0030_sequence 1 attaaagaggagaaa BBa_K1620004_sequence 1 atggaaaagaccacaacgcaggagttattagcgcaggctgaaaaaatctgcgcgcagcgtaatgtgcgcctgaccccacagcgcctggaagtgttgcgcctgatgagtctgcaagatggcgctatcagcgcttatgatctgcttgatttactgcgcgaagctgaaccgcaagccaagccgccaacggtttatcgcgcgctggattttctgcttgagcaaggttttgtgcataaggtggaatccaccaacagttatgtgctctgtcatctgttcgatcagcccacccatacgtcagccatgtttatttgcgatcgctgcggcgcagtgaaagaagagtgtgcagaaggcgtggaagacattatgcatacgctggcggcaaaaatggggtttgccctgcggcataatgtgattgaagcacatgggctctgtgcggcatgtgtagaagtggaagcgtgtcgtcatcctgaacagtgccagcatgatcactctgtgcaggtgaaaaagaaaccgcgttaataa BBa_S05282_sequence 1 attaaagaggagaaatactagatggaaaagaccacaacgcaggagttattagcgcaggctgaaaaaatctgcgcgcagcgtaatgtgcgcctgaccccacagcgcctggaagtgttgcgcctgatgagtctgcaagatggcgctatcagcgcttatgatctgcttgatttactgcgcgaagctgaaccgcaagccaagccgccaacggtttatcgcgcgctggattttctgcttgagcaaggttttgtgcataaggtggaatccaccaacagttatgtgctctgtcatctgttcgatcagcccacccatacgtcagccatgtttatttgcgatcgctgcggcgcagtgaaagaagagtgtgcagaaggcgtggaagacattatgcatacgctggcggcaaaaatggggtttgccctgcggcataatgtgattgaagcacatgggctctgtgcggcatgtgtagaagtggaagcgtgtcgtcatcctgaacagtgccagcatgatcactctgtgcaggtgaaaaagaaaccgcgttaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z