BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916610 1 BBa_B0010 component1916612 1 BBa_B0012 annotation1916612 1 BBa_B0012 range1916612 1 89 129 annotation1916610 1 BBa_B0010 range1916610 1 1 80 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_S05284 1 BBa_S05284 K1620007:B0015 2015-09-03T11:00:00Z 2015-09-04T08:37:26Z false false _9_ 23597 23597 9 false false Celio Dias Santos Jr component2443644 1 BBa_K1620007 component2443651 1 BBa_B0015 annotation2443644 1 BBa_K1620007 range2443644 1 1 171 annotation2443651 1 BBa_B0015 range2443651 1 180 308 BBa_K1620007 1 SmtA Synechococcus metallothionenin A (SmtA) 2015-09-03T11:00:00Z 2015-09-13T04:07:16Z This part is an improvement of part BBa_K519010. It was synthesized by IDT as G-block and amplified by PCR using the following primers: Fwd: 5' - GAA TTC GCG GCC GCT TCT AGA GAT GAC CTC AAC AAC GTT GGT - 3' Rev: 5' - TAC TAG TAG CGG CCG CTG CAG TTA GCC GTG GCA GTT ACA GC - 3' After this, the 3A assembly method was carried out. SmtA is a metallothionein which bind to divalent metallic cations such as Zn(II). This SmtA was an improvement of the biobrick BBa_K519010 originally cloned from Synechococcus sp. PCC7942, a cyanobacterial strain. SmtA is a low cys content type II metallothionein. Other team (iGEM11_Tokyo-NoKoGen, 2011-09-30) have previously find SmtA constitutively expressed in E. coli improving its growth at a high Cd(II) concentrationwhen compared to wild type E. coli. false false _2037_ 23597 23597 9 false This part was designed to eliminate an internal restriction site for PstI, the 98th base was changed G -> A. No residues were changed. false Celio Dias Santos Jr annotation2443638 1 Rev range2443638 1 151 171 annotation2443640 1 Fwd range2443640 1 1 20 annotation2443639 1 SmtA range2443639 1 1 171 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1686 1 T7 TE range1686 1 8 27 annotation1687 1 stop range1687 1 34 34 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K1620007_sequence 1 atgacctcaacaacgttggtcaaatgcgcttgtgagccctgtctctgcaacgtcgatcccagcaaagcgatcgatcgcaacggtctgtactactgcaacgaagcctgtgccgatggccacaccggtggtagcaaaggctgcggccacaccggctgtaactgccacggctaa BBa_S05284_sequence 1 atgacctcaacaacgttggtcaaatgcgcttgtgagccctgtctctgcaacgtcgatcccagcaaagcgatcgatcgcaacggtctgtactactgcaacgaagcctgtgccgatggccacaccggtggtagcaaaggctgcggccacaccggctgtaactgccacggctaatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z