BBa_K1616011 1 RBS-rev RBS reversed 2015-09-16T11:00:00Z 2015-09-17T10:56:58Z This part is the reverse sequence of the BBa_I712074 promoter T7. For more efficiency of construction, scientists use more and more reversed promoter and then reversed sequences of proteins coding. This part have been created in order to recruit transcriptional machinery and lead to transcritpion of the upstream DNA sequence. So, this part is the reverse sequence of the BBa_I712074 promoter T7. false false _2033_ 22805 22805 9 false We have checked that any illegal sites was formed. false Johanna Chesnel annotation2466086 1 RBS Reversed range2466086 1 1 14 BBa_S05310 1 BBa_S05310 B0025:K1616011 2015-09-16T11:00:00Z 2015-09-17T09:29:10Z false false _9_ 22805 22805 9 false false Johanna Chesnel component2466097 1 BBa_K1616011 component2466095 1 BBa_B0025 annotation2466097 1 BBa_K1616011 range2466097 1 138 151 annotation2466095 1 BBa_B0025 range2466095 1 1 129 BBa_B0025 1 BBa_B0025 double terminator (B0015), reversed 2003-12-02T12:00:00Z 2015-08-31T04:07:20Z -- No description -- false true _1_ 0 24 7 In stock false true Caitlin Conboy annotation369703 1 B0010 range369703 1 50 129 annotation369702 1 B0012 range369702 1 1 41 BBa_K1616011_sequence 1 ttgtcccctctttc BBa_B0025_sequence 1 tataaacgcagaaaggcccacccgaaggtgagccagtgtgactctagtagagagcgttcaccgacaaacaacagataaaacgaaaggcccagtctttcgactgagcctttcgttttatttgatgcctgg BBa_S05310_sequence 1 tataaacgcagaaaggcccacccgaaggtgagccagtgtgactctagtagagagcgttcaccgacaaacaacagataaaacgaaaggcccagtctttcgactgagcctttcgttttatttgatgcctggtactagagttgtcccctctttc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z