BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 BBa_S05336 1 BBa_S05336 K844000:B0015 2016-10-09T11:00:00Z 2016-10-19T09:39:35Z false false _9_ 25587 25587 9 false false Fiona Tsai component2524334 1 BBa_K844000 component2524341 1 BBa_B0015 annotation2524341 1 BBa_B0015 range2524341 1 45 173 annotation2524334 1 BBa_K844000 range2524334 1 1 36 BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916610 1 BBa_B0010 component1916612 1 BBa_B0012 annotation1916612 1 BBa_B0012 range1916612 1 89 129 annotation1916610 1 BBa_B0010 range1916610 1 1 80 BBa_K844000 1 BBa_K844000 10x-Histidine (10x-His) Tag with double stop codon (TAATAA) 2012-10-01T11:00:00Z 2015-05-08T01:13:33Z Constructed through oligonucleotide annealing Released HQ 2013 10x-Histidine tag with double stop codon TAATAA to allow for better extraction of tagged products and protein termination in a single part. false false _1104_ 0 9404 9 In stock true none false Kathleen Miller annotation2206607 1 10x-Histidine Tag range2206607 1 1 30 annotation2206609 1 Stop range2206609 1 34 36 annotation2206608 1 Stop range2206608 1 31 33 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_S05336_sequence 1 catcatcaccatcaccaccatcatcaccattaataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K844000_sequence 1 catcatcaccatcaccaccatcatcaccattaataa BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z