BBa_S05355 1 BBa_S05355 J23119:B0034 2016-10-12T11:00:00Z 2016-10-13T12:33:03Z false false _9_ 19009 19009 9 false false Bob Van Hove component2499223 1 BBa_B0034 component2499221 1 BBa_J23119 annotation2499221 1 BBa_J23119 range2499221 1 1 35 annotation2499223 1 BBa_B0034 range2499223 1 44 55 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_S05356 1 BBa_S05356 S05355:K1896001 2016-10-12T11:00:00Z 2016-10-13T12:34:13Z false false _9_ 19009 19009 9 false false Bob Van Hove component2499237 1 BBa_K1896001 component2499228 1 BBa_S05355 annotation2499228 1 BBa_S05355 range2499228 1 1 55 annotation2499237 1 BBa_K1896001 range2499237 1 62 778 BBa_J23119 1 BBa_J23119 constitutive promoter family member 2006-08-23T11:00:00Z 2015-08-31T04:08:40Z Overlap extension of synthetic oligonucleotides Released HQ 2013 Later false true _52_ 0 483 95 In stock false N/A true John Anderson BBa_K1896001 1 BBa_K1896001 mGFPuv2 2016-10-11T11:00:00Z 2016-10-14T05:25:03Z We started from pBAD-GFPuv (GenBank: U62637.1, Clontech), applied the described mutations and codon optimised the sequence for ''E. coli''. ===References=== # von Stetten, D., Noirclerc-Savoye, M., Goedhart, J., Gadella, T. W., &amp; Royant, A. (2012). Structure of a fluorescent protein from ''Aequorea victoria'' bearing the obligate-monomer mutation A206K. ''Acta Crystallographica Section F: Structural Biology and Crystallization Communications'', 68(8), 878-882. # Ito, Y., Suzuki, M., &amp; Husimi, Y. (1999). A novel mutant of green fluorescent protein with enhanced sensitivity for microanalysis at 488 nm excitation. ''Biochemical and biophysical research communications'', 264(2), 556-560. # Crameri, A., Whitehorn, E. A., Tate, E., Stemmer, W. P., Crameri, A., Kitts, P. A., &amp; Kitts, P. A. (1996). Improved green fluorescent protein by molecular evolution using. ''Nat. Biotechnol'', 14(3), 315-319. Variant of Green Fluorescent Protein (GFP) that contains the following mutations: * '''F99S/M153T/V163A''': GFPuv or ''cycle 3'' GFP was optimised for excitation by UV light (360-400nm). [1] * '''S208L''': Almost doubles the fluorescent intensity of GFPuv, resulting in GFPuv2. [2] * '''A206K''': Monomerizes most GFP variants by disrupting a hydrophobic patch. [3] false false _2362_ 19009 19009 9 false After codon optimisation, 2 BsaI sites were removed. false Bob Van Hove, Maarten Van Brempt annotation2495311 1 F99S range2495311 1 295 297 annotation2495308 1 start range2495308 1 1 3 annotation2495318 1 A206K range2495318 1 616 618 annotation2495316 1 M153T range2495316 1 457 459 annotation2495309 1 stop range2495309 1 715 717 annotation2495310 1 mGFPuv2 range2495310 1 1 717 annotation2495319 1 S208L range2495319 1 622 624 annotation2495317 1 V163A range2495317 1 487 489 BBa_S05355_sequence 1 ttgacagctagctcagtcctaggtataatgctagctactagagaaagaggagaaa BBa_B0034_sequence 1 aaagaggagaaa BBa_K1896001_sequence 1 atgagtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttctcttatggtgttcaatgcttttcccgttatccggatcatatgaaacggcatgactttttcaagagtgccatgcccgaaggttatgtacaggaacgcactatatctttcaaagatgacgggaactacaagacgcgtgctgaagtcaagtttgaaggtgatacccttgttaatcgtatcgagttaaaaggtattgattttaaagaagatggaaacattctcggacacaaactggagtacaactataactcacacaatgtatacatcacggcagacaaacaaaagaatggaatcaaagctaacttcaaaattcgccacaacattgaagatggctccgttcaactagcagaccattatcaacaaaatactccaattggtgatggccctgtccttttaccagacaaccattacctgtcgacacaatctaaacttttgaaagatcccaacgaaaagcgtgaccacatggtccttcttgagtttgtaactgctgctgggattacacatggcatggatgagctctacaaataa BBa_S05356_sequence 1 ttgacagctagctcagtcctaggtataatgctagctactagagaaagaggagaaatactagatgagtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttctcttatggtgttcaatgcttttcccgttatccggatcatatgaaacggcatgactttttcaagagtgccatgcccgaaggttatgtacaggaacgcactatatctttcaaagatgacgggaactacaagacgcgtgctgaagtcaagtttgaaggtgatacccttgttaatcgtatcgagttaaaaggtattgattttaaagaagatggaaacattctcggacacaaactggagtacaactataactcacacaatgtatacatcacggcagacaaacaaaagaatggaatcaaagctaacttcaaaattcgccacaacattgaagatggctccgttcaactagcagaccattatcaacaaaatactccaattggtgatggccctgtccttttaccagacaaccattacctgtcgacacaatctaaacttttgaaagatcccaacgaaaagcgtgaccacatggtccttcttgagtttgtaactgctgctgggattacacatggcatggatgagctctacaaataa BBa_J23119_sequence 1 ttgacagctagctcagtcctaggtataatgctagc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z