BBa_C0060 1 aiiA autoinducer inactivation enzyme from Bacillus; hydrolyzes acetyl homoserine lactone 2003-01-31T12:00:00Z 2015-08-31T04:07:23Z <genbank>AF196486</genbank> from <em>Bacillus</em> sp. 240B1 putative metallohydrolase (<em>aiiA</em>) gene. <BR> Dong,Y.H., Xu,J.L., Li,X.Z. and Zhang,L.H.: AiiA, an enzyme that inactivates the acylhomoserine lactone quorum-sensing signal and attenuates the virulence of <em>Erwinia<br> carotovora</em>, Proc. Natl. Acad. Sci. U.S.A. 97 (7), 3526-3531 (2000).<br> Released HQ 2013 Coding region for the autoinducer inactivation enzyme A (<em>aiiA</em>) LVA tagged. The gene was originally isolated from <em>Bacillus</em> sp. 240B1 and it encodes an enzyme that catalyzes the degradation of N-acyl homoserine lactones (AHLs)--quorum sensing autoinducers.</P> false false _1_ 0 24 7 In stock false References (unparsed) here: <p>Dong,Y.H., Xu,J.L., Li,X.Z. and Zhang,L.H.: AiiA, an enzyme that inactivates the acylhomoserine lactone quorum-sensing signal and attenuates the virulence of <em>Erwinia<br> carotovora</em>, Proc. Natl. Acad. Sci. U.S.A. 97 (7), 3526-3531 (2000). <a href="#">http://www.pnas.org/cgi/content/full/97/7/3526</a></P> <P>Lee SJ, Park SY, Lee JJ, Yum DY, Koo BT, Lee JK.: Genes encoding the N-acyl homoserine lactone-degrading enzyme are widespread in many subspecies of Bacillus thuringiensis, Appl Environ Microbiol 2002 Aug;68(8):3919-24. <a href="#">http://aem.asm.org/cgi/content/full/68/8/3919?view=full&pmid=12147491</a><br> <br> </P> <P> References (unparsed) here: <p>Dong,Y.H., Xu,J.L., Li,X.Z. and Zhang,L.H.: AiiA, an enzyme that inactivates the acylhomoserine lactone quorum-sensing signal and attenuates the virulence of <em>Erwinia<br> carotovora</em>, Proc. Natl. Acad. Sci. U.S.A. 97 (7), 3526-3531 (2000). <a href="#">http://www.pnas.org/cgi/content/full/97/7/3526</a></P> <P>Lee SJ, Park SY, Lee JJ, Yum DY, Koo BT, Lee JK.: Genes encoding the N-acyl homoserine lactone-degrading enzyme are widespread in many subspecies of Bacillus thuringiensis, Appl Environ Microbiol 2002 Aug;68(8):3919-24. <a href="#">http://aem.asm.org/cgi/content/full/68/8/3919?view=full&pmid=12147491</a><br> <br> </P> <P>BBa_C0060 insert contains open reading frame (nucleotides 49-801) of the GeneBank sequence AF196486 followed by the LVA tag and two double stop codons inserted in the BioBrick prefix and suffix flanking regions. The original stop codon was TAG and in the present sequence it was substituted by TAATAA.<P> true Vinay S Mahajan, Brian Chow, Peter Carr, Voichita D. Marinescu and Alexander D. Wissner-Gross annotation1755 1 2 range1755 1 784 789 annotation7037 1 BBa_C0060 range7037 1 1 789 annotation1757 1 aiiA range1757 1 1 750 annotation1754 1 start range1754 1 1 3 annotation1756 1 LVA range1756 1 751 783 annotation2213987 1 Help:Barcodes range2213987 1 790 814 BBa_S3911 1 BBa_S3911 C0060.B0015 2004-08-06T11:00:00Z 2015-05-08T01:14:52Z C0060.B0015 false false _11_1_ 0 61 7 In stock false false jcbraff component1033970 1 BBa_B0012 component1033960 1 BBa_B0010 component1033951 1 BBa_C0060 annotation1033960 1 BBa_B0010 range1033960 1 823 902 annotation1033951 1 BBa_C0060 range1033951 1 1 789 annotation1033970 1 BBa_B0012 range1033970 1 911 951 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_C0060_sequence 1 atgacagtaaagaagctttatttcgtcccagcaggtcgttgtatgttggatcattcgtctgttaatagtacattaacaccaggagaattattagacttaccggtttggtgttatcttttggagactgaagaaggacctattttagtagatacaggtatgccagaaagtgcagttaataatgaaggtctttttaacggtacatttgtcgaagggcaggttttaccgaaaatgactgaagaagatagaatcgtgaatattttaaaacgggttggttatgagccggaagaccttctttatattattagttctcacttgcattttgatcatgcaggaggaaatggcgcttttataaatacaccaatcattgtacagcgtgctgaatatgaggcggcgcagcatagcgaagaatatttgaaagaatgtatattgccgaatttaaactacaaaatcattgaaggtgattatgaagtcgtaccaggagttcaattattgcatacaccaggccatactccagggcatcaatcgctattaattgagacagaaaaatccggtcctgtattattaacgattgatgcatcgtatacgaaagagaattttgaaaatgaagtgccatttgcgggatttgattcagaattagctttatcttcaattaaacgtttaaaagaagtggtgatgaaagagaagccgattgttttctttggacatgatatagagcaggaaaggggatgtaaagtgttccctgaatatatagctgcaaacgacgaaaactacgctttagtagcttaataacgctgatagtgctagtgtagatcgc BBa_S3911_sequence 1 atgacagtaaagaagctttatttcgtcccagcaggtcgttgtatgttggatcattcgtctgttaatagtacattaacaccaggagaattattagacttaccggtttggtgttatcttttggagactgaagaaggacctattttagtagatacaggtatgccagaaagtgcagttaataatgaaggtctttttaacggtacatttgtcgaagggcaggttttaccgaaaatgactgaagaagatagaatcgtgaatattttaaaacgggttggttatgagccggaagaccttctttatattattagttctcacttgcattttgatcatgcaggaggaaatggcgcttttataaatacaccaatcattgtacagcgtgctgaatatgaggcggcgcagcatagcgaagaatatttgaaagaatgtatattgccgaatttaaactacaaaatcattgaaggtgattatgaagtcgtaccaggagttcaattattgcatacaccaggccatactccagggcatcaatcgctattaattgagacagaaaaatccggtcctgtattattaacgattgatgcatcgtatacgaaagagaattttgaaaatgaagtgccatttgcgggatttgattcagaattagctttatcttcaattaaacgtttaaaagaagtggtgatgaaagagaagccgattgttttctttggacatgatatagagcaggaaaggggatgtaaagtgttccctgaatatatagctgcaaacgacgaaaactacgctttagtagcttaataacgctgatagtgctagtgtagatcgctactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z