BBa_T1002 1 BBa_T1002 Testing the categories 2009-05-09T11:00:00Z 2015-05-08T01:14:52Z test test true true _1_ 0 25 46 Discontinued true test false Randy Rettberg component2383830 1 BBa_C0040 component2383831 1 BBa_B0012 component2383826 1 BBa_B0040 component2383824 1 BBa_T1001 annotation2383826 1 BBa_B0040 range2383826 1 61 130 annotation2383831 1 BBa_B0012 range2383831 1 830 870 annotation2383824 1 BBa_T1001 range2383824 1 1 52 annotation2383830 1 BBa_C0040 range2383830 1 137 821 BBa_T1001 1 BBa_T1001 Kill this part 2009-05-04T11:00:00Z 2015-05-08T01:14:52Z None Test part for the assembly system mechanism false false _1_ 0 25 46 It's complicated false none false Randy Rettberg annotation2378354 1 [10] range2378354 1 21 26 BBa_B0040 1 spacer Spacer.1 (generic) 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Randomly generated and optimized for several parameters (see Design notes). Released HQ 2013 Generic spacer for ensuring a 70 bp distance between the end of the suffix of the BioBrick part containing the double terminator and the prefix of the BioBrick part containing the promoter of the new gene. Please, use the AlignX function of Vector NT to check for homology with the components in your plasmid before using this spacer.</P> false false _1_ 0 24 7 In stock false <P> <P><p>The size of the spacer was choosed to meet the minimum length of a sequence that can be queried using the BLAST search engine. However, subsequences of it can be used to design shorter spacers. The sequence was selected from many more sequences randomly generated using the <a href="http://www.lifesci.ucsb.edu/~maduro/random.htm">Random DNA Generator </a>engine; the GC% parameter used as input was 50%. The sequences were selected based on the following constraints listed in their order of importance: the absence of any putative promoter regions, a low degree of homology with the Elowitz plasmid (whose components are widely used in our designs), no homology with other <em>E.coli</em> sequences as shown by BLASTN search results and the presence of a number of TAA stop codons. The second constraint was the most stringent leading to the elimination of most sequences. </p> <p> DE made the following changes to the original sequence in order to add stop codons in the -3 frame and more in the +2 frame (note, not all of these stop codons are UAA. Thus, if used in an organism that inserts an amino acid @ UGA or UAG the obvious will occur):<br> T->A @ 85<br> T->A @ 42<br> C->T @ 79<br> A->T @ 64<br> A->T @ 31<br> T->A @ 34<br> C->A @ 37<br> Also, note that the above changes further reduce (the already very weak) homology to current NCBI-stored sequences.<br> </p> <P>In the process of selecting the best sequence it appeared that a good alternative sequence for a spacer would be: AGGTTCTGATATGTAACTGTGCCCAATGTCGTTAGTGACGCATACCTCTTAAGAGGCCACTGTCCTAACA. The sequence contains no putative promoters and shows moderate homology with the 5' end of the Ampicillin resistance gene. However a strong promoter sequence starts 12 bp downstream of this sequence, and therefore the sequence presented above was preferred. </p><P> The sequence is compatible (does not show significant homology) with the components in the Elowitz repressilator plasmid. true Vinay S. Mahajan, Brian Chow, Peter Carr annotation1721 1 Spacer-1 range1721 1 1 70 annotation7030 1 BBa_B0040 range7030 1 1 70 BBa_T1006 1 BBa_T1006 Kill this part 2011-05-23T11:00:00Z 2015-05-08T01:14:52Z None Kill this part. It is for testing add_part_c false false _1_ 0 25 397 Not in stock false None false Randy Rettberg component2373672 1 BBa_T1002 component2373665 1 BBa_B0010 component2373668 1 BBa_B0012 component2373657 1 BBa_T1001 annotation2373657 1 BBa_T1001 range2373657 1 1 52 annotation2373672 1 BBa_T1002 range2373672 1 53 1010 annotation2373668 1 BBa_B0012 range2373668 1 970 1010 annotation2373665 1 BBa_B0010 range2373665 1 882 961 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 BBa_C0040 1 tetR tetracycline repressor from transposon Tn10 (+LVA) 2003-01-31T12:00:00Z 2015-08-31T04:07:23Z Elowitz, M. B. Transport, Assembly, and Dynamics in Systems of Interacting Proteins. Thesis, Princeton Univ., Princeton (1999) Released HQ 2013 Coding region for the TetR protein without the Ribosome Binding Site. Modified with an LVA tail for rapid degradation of the protein and faster fall time for the emission. TetR binds to the pTet regulator (BBa_R0040). aTc (anhydrotetracycline) binds to TetR and inhibits its operation.</P> false true _1_ 0 24 7 In stock false References (unparsed) here: <p>Elowitz, M. B. Transport, Assembly, and Dynamics in Systems of Interacting Proteins. Thesis, Princeton Univ., Princeton (1999). </P> <p> Lutz R, Bujard H., Independent and tight regulation of transcriptional units in Escherichia coli via the LacR/O, the TetR/O and AraC/I1-I2 regulatory elements. Nucleic Acids Res. 1997 Mar 15;25(6):1203-10. PMID: 9092630 </p> <P> References (unparsed) here: <p>Elowitz, M. B. Transport, Assembly, and Dynamics in Systems of Interacting Proteins. Thesis, Princeton Univ., Princeton (1999). </P> <p> Lutz R, Bujard H., Independent and tight regulation of transcriptional units in Escherichia coli via the LacR/O, the TetR/O and AraC/I1-I2 regulatory elements. Nucleic Acids Res. 1997 Mar 15;25(6):1203-10. PMID: 9092630 </p> <P>BBa_C0040 TetR Protein is based on the TetR sequence from Elowitz's repressilator. It has been modified to include a rapid degradation LVA tail, and includes the BioBrick standard assembly head and tail restriction sites. The RBS has been removed. The stop codon has been changed from TAA to a double stop codon TAATAA. <P> true June Rhee, Connie Tao, Ty Thomson, Louis Waldman. annotation23329 1 tetR range23329 1 4 620 annotation2213989 1 Help:Barcodes range2213989 1 661 685 annotation23330 1 SsrA range23330 1 621 654 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_B0040_sequence 1 aggttctgttaagtaactgaacccaatgtcgttagtgacgcttacctcttaagaggtcactgacctaaca BBa_T1002_sequence 1 taagaaaaaaaaatctagaaaaaaaaatctagaaaaaaaaaaaagaattttttactagagaggttctgttaagtaactgaacccaatgtcgttagtgacgcttacctcttaagaggtcactgacctaacatactagatgtccagattagataaaagtaaagtgattaacagcgcattagagctgcttaatgaggtcggaatcgaaggtttaacaacccgtaaactcgcccagaagctaggtgtagagcagcctacattgtattggcatgtaaaaaataagcgggctttgctcgacgccttagccattgagatgttagataggcaccatactcacttttgccctttagaaggggaaagctggcaagattttttacgtaataacgctaaaagttttagatgtgctttactaagtcatcgcgatggagcaaaagtacatttaggtacacggcctacagaaaaacagtatgaaactctcgaaaatcaattagcctttttatgccaacaaggtttttcactagagaatgcattatatgcactcagcgctgtggggcattttactttaggttgcgtattggaagatcaagagcatcaagtcgctaaagaagaaagggaaacacctactactgatagtatgccgccattattacgacaagctatcgaattatttgatcaccaaggtgcagagccagccttcttattcggccttgaattgatcatatgcggattagaaaaacaacttaaatgtgaaagtgggtccgctgcaaacgacgaaaactacgctttagtagcttaataacactgatagtgctagtgtagatcactactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_T1001_sequence 1 taagaaaaaaaaatctagaaaaaaaaatctagaaaaaaaaaaaagaattttt BBa_C0040_sequence 1 atgtccagattagataaaagtaaagtgattaacagcgcattagagctgcttaatgaggtcggaatcgaaggtttaacaacccgtaaactcgcccagaagctaggtgtagagcagcctacattgtattggcatgtaaaaaataagcgggctttgctcgacgccttagccattgagatgttagataggcaccatactcacttttgccctttagaaggggaaagctggcaagattttttacgtaataacgctaaaagttttagatgtgctttactaagtcatcgcgatggagcaaaagtacatttaggtacacggcctacagaaaaacagtatgaaactctcgaaaatcaattagcctttttatgccaacaaggtttttcactagagaatgcattatatgcactcagcgctgtggggcattttactttaggttgcgtattggaagatcaagagcatcaagtcgctaaagaagaaagggaaacacctactactgatagtatgccgccattattacgacaagctatcgaattatttgatcaccaaggtgcagagccagccttcttattcggccttgaattgatcatatgcggattagaaaaacaacttaaatgtgaaagtgggtccgctgcaaacgacgaaaactacgctttagtagcttaataacactgatagtgctagtgtagatcac BBa_T1006_sequence 1 taagaaaaaaaaatctagaaaaaaaaatctagaaaaaaaaaaaagaattttttaagaaaaaaaaatctagaaaaaaaaatctagaaaaaaaaaaaagaattttttactagagaggttctgttaagtaactgaacccaatgtcgttagtgacgcttacctcttaagaggtcactgacctaacatactagatgtccagattagataaaagtaaagtgattaacagcgcattagagctgcttaatgaggtcggaatcgaaggtttaacaacccgtaaactcgcccagaagctaggtgtagagcagcctacattgtattggcatgtaaaaaataagcgggctttgctcgacgccttagccattgagatgttagataggcaccatactcacttttgccctttagaaggggaaagctggcaagattttttacgtaataacgctaaaagttttagatgtgctttactaagtcatcgcgatggagcaaaagtacatttaggtacacggcctacagaaaaacagtatgaaactctcgaaaatcaattagcctttttatgccaacaaggtttttcactagagaatgcattatatgcactcagcgctgtggggcattttactttaggttgcgtattggaagatcaagagcatcaagtcgctaaagaagaaagggaaacacctactactgatagtatgccgccattattacgacaagctatcgaattatttgatcaccaaggtgcagagccagccttcttattcggccttgaattgatcatatgcggattagaaaaacaacttaaatgtgaaagtgggtccgctgcaaacgacgaaaactacgctttagtagcttaataacactgatagtgctagtgtagatcactactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z