BBa_J61101 1 BBa_J61101 Ribosome Binding Site Family Member 2007-01-28T12:00:00Z 2015-08-31T02:03:00Z N/A fix false false _95_ 0 483 95 In stock false N/A true John Anderson BBa_T1012 1 BBa_T1012 Test K206000 without K628000 2011-09-19T11:00:00Z 2015-05-08T01:14:52Z a a false false _853_ 0 25 397 Not in stock false a false Randy Rettberg component2135566 1 BBa_J61101 component2135573 1 BBa_B0015 component2135565 1 BBa_K206000 annotation2135565 1 BBa_K206000 range2135565 1 1 130 annotation2135573 1 BBa_B0015 range2135573 1 159 287 annotation2135566 1 BBa_J61101 range2135566 1 139 150 BBa_K206000 1 pBAD pBAD strong 2009-10-13T11:00:00Z 2015-05-08T01:11:23Z The sequence was obtained by applying all mutations that upregulated AraC binding and subsequent promoter activity listed in reference [1]. Released HQ 2013 pBAD is an <i>E.coli</i> promoter that is induced by L-arabinose. K206000 is a mutagenized pBAD promoter that is responsive to lower concentrations of arabinose than wild type (<partinfo>I13453</partinfo>) and, additionally, exhibits a higher maximum of protein expression as measured by coupling to a fluorescent reporter. false false _307_ 0 4172 9 In stock true There were no special design considerations. false Amelia Hardjasa annotation2049252 1 promoter range2049252 1 1 131 annotation2049253 1 AraI1 range2049253 1 40 57 annotation2049254 1 AraI2 range2049254 1 61 78 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916610 1 BBa_B0010 component1916612 1 BBa_B0012 annotation1916612 1 BBa_B0012 range1916612 1 89 129 annotation1916610 1 BBa_B0010 range1916610 1 1 80 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_J61101_sequence 1 aaagacaggacc BBa_T1012_sequence 1 acattgattatttgcacggcgtcacactttgctatgccatagcaagatagtccataagattagcggatcctacctgacgctttttatcgcaactctctactgtttctccataccgtttttttgggctagctactagagaaagacaggacctactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K206000_sequence 1 acattgattatttgcacggcgtcacactttgctatgccatagcaagatagtccataagattagcggatcctacctgacgctttttatcgcaactctctactgtttctccataccgtttttttgggctagc BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z