BBa_T2000 1 7x His 7x His tag tail domain 2009-08-10T11:00:00Z 2015-05-08T01:14:52Z No. This is a synthetic sequence. This is a 6x His tag tail domain designed to encode the C-terminus of a protein. His tags are a type of affinity tag that can be used to purify and/or measure the quantity of proteins. false true _41_ 0 126 162 Not in stock false Used both His codons in order to avoid repeats. Also included a double TAATAA stop codon. false Reshma Shetty annotation2016496 1 double stop codon range2016496 1 22 27 annotation2016495 1 7x His range2016495 1 1 21 BBa_T2000_sequence 1 caccatcaccatcaccatcactaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z