BBa_T2001 1 7x His 7x His tag head domain 2009-08-10T11:00:00Z 2015-05-08T01:14:52Z This is a synthetic sequence. This is a 6x His tag head domain designed to encode the N-terminus of a protein. His tags are a type of affinity tag that can be used to purify and/or measure the quantity of proteins. false true _41_ 0 126 162 Not in stock false Both Histidine codons were used to minimize repeats. An ATG start codon was used. false Reshma Shetty annotation2016497 1 start codon range2016497 1 1 3 annotation2017305 1 preferred AAA +2 codon range2017305 1 4 6 annotation2016498 1 7x his tag range2016498 1 7 27 BBa_T2001_sequence 1 atgaaacaccatcaccatcaccatcac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z