BBa_T2002 1 7xHis 7x His tag special internal domain 2009-08-10T11:00:00Z 2015-05-08T01:14:52Z This is a synthetic sequence. This is a 6x His tag special internal domain is designed to be between protein domains. His tags are a type of affinity tag that can be used to purify and/or measure the quantity of proteins. false false _41_ 0 126 162 Not in stock false Used both Histidine codons to minimize repeats. false Reshma Shetty annotation2016499 1 7x His range2016499 1 1 21 BBa_T2002_sequence 1 caccatcaccatcaccatcac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z