BBa_T2003 1 FLAG FLAG octapeptide tail domain (DYKDDDDK) 2006-10-25T11:00:00Z 2015-05-08T01:14:52Z none kill this part false false _1_ 0 25 1 It's complicated false none false Reshma Shetty annotation2016710 1 FLAG tag octapeptide range2016710 1 1 24 annotation2016711 1 double stop codon range2016711 1 25 30 BBa_T2003_sequence 1 gactataaggatgacgatgacaaataataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z