BBa_T2004 1 FLAG FLAG octapeptide head domain (DYKDDDDK) 2008-04-30T11:00:00Z 2015-05-08T01:14:52Z test Test of composite parts false true _1_ 0 25 11 Not in stock false test false Reshma Shetty annotation2017174 1 start codon range2017174 1 1 3 annotation2017306 1 preferred AAA +2 codon range2017306 1 4 6 annotation2017175 1 FLAG octapeptide range2017175 1 7 30 BBa_T2004_sequence 1 atgaaagactataaggatgacgatgacaaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z