BBa_T2005 1 FLAG FLAG octapeptide special internal domain (DYKDDDDK) 2009-08-10T11:00:00Z 2015-05-08T01:14:52Z This is a synthetic sequence. This is a FLAG tag octapeptide special internal domain designed to be internal to the sequence of a protein. FLAG tags are a type of affinity tag that can be used to purify and/or measure the quantity of proteins. false false _41_ 0 126 162 Not in stock false The FLAG sequence AspTyrLysAspAspAspAspLys (DYKDDDDK) is one of the most commonly used FLAG tag sequences. Each of the amino acids in this octapeptide have two possible codon choices. For each amino acid, neither of the two codon choices appear to be rare in the common model organisms. So codons were selected to minimize repeats. false Reshma Shetty annotation2017176 1 FLAG octapeptide range2017176 1 1 24 BBa_T2005_sequence 1 gactataaggatgacgatgacaaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z