BBa_T2006 1 c-Myc c-Myc tail domain (EQKLISEEDL) 2009-08-10T11:00:00Z 2015-05-08T01:14:52Z This is a synthetic sequence. This is a c-Myc tag head domain designed to be at the C-terminus of a protein. c-Myc tags are a type of affinity tag that can be used to purify and/or measure the quantity of proteins. false true _41_ 0 126 162 Not in stock false This tail domain encodes the c-Myc sequence EQKLISEEDL. The codons at each amino acid position were selected to avoid rare codons in organisms like ''E. coli'', humans, mouse, ''B. subtilis'', ''C. elegans'', ''Streptomyces coelicolor'' and other common model organisms and/or industrial hosts. false Reshma Shetty annotation2017177 1 c-Myc tag range2017177 1 1 30 annotation2017178 1 double stop codon range2017178 1 31 36 BBa_T2006_sequence 1 gaacagaagctgatctccgaggaagacctgtaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z