BBa_T2008 1 c-Myc c-Myc special internal domain (EQKLISEEDL) 2009-08-10T11:00:00Z 2015-05-08T01:14:52Z This is a synthetic sequence. This is a c-Myc tag special internal domain designed to be within a protein. c-Myc tags are a type of affinity tag that can be used to purify and/or measure the quantity of proteins. false false _41_ 0 126 162 Not in stock false This domain encodes the c-Myc sequence EQKLISEEDL. The codons at each amino acid position were selected to avoid rare codons in organisms like E. coli, humans, mouse, B. subtilis, C. elegans, Streptomyces coelicolor and other common model organisms and/or industrial hosts. false Reshma Shetty annotation2017181 1 c-Myc tag range2017181 1 1 30 BBa_T2008_sequence 1 gaacagaagctgatctccgaggaagacctg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z