BBa_T2014 1 Strep-tag Strep-tag II special internal domain (WSHPQFEK) 2009-08-12T11:00:00Z 2015-05-08T01:14:52Z This is a synthetic sequence. This is a Strep tag tail domain designed to be internal to a protein. Strep tags are typically used for detection, purification and immobilization of proteins. false false _41_ 0 126 162 Not in stock false This domain encodes the Strep tag sequence WRHPQFGG. The codons at each amino acid position were selected to avoid rare codons as much as possible in organisms like ''E. coli'', humans, mouse, ''B. subtilis'', ''C. elegans'', ''Streptomyces coelicolor'' and other common model organisms and/or industrial hosts. Another factor in codon selection was avoiding avoid repeat sequences. false Reshma Shetty annotation2017312 1 Strep-tag II range2017312 1 1 24 BBa_T2014_sequence 1 tggtcccaccctcagttcgaaaag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z