BBa_T2016 1 S-tag S-tag head domain (KETAAAKFERQHMDS) 2009-09-02T11:00:00Z 2015-05-08T01:14:52Z This is a synthetic sequence This is a S-tag head domain designed to be at the N-terminus of a protein. S-tags are a type of affinity tag that can be used to purify and/or measure the quantity of proteins. false false _41_ 0 126 162 Not in stock false This head domain begins with Met-Lys to promote efficient translation of the protein in ''E. coli''. false Reshma Shetty annotation2018272 1 preferred AAA +2 codon range2018272 1 4 6 annotation2018271 1 start codon range2018271 1 1 3 annotation2018273 1 S-tag range2018273 1 7 51 BBa_T2016_sequence 1 atgaaaaaggagaccgcggccgcgaaattcgaacgccaacacatggactcc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z