BBa_T9150 1 PyrF orotidine 5 2005-08-22T11:00:00Z 2015-05-08T01:14:53Z Coding region for PyrF gene. PyrF is used in the synthesis of uracil in the same pathway that Ura3 is used in yeast. Can also be used as a conterselectable marker in the presence of 5-Fluoroorotic Acid (5-FOA) and the absence of uracil. false false _11_1_ 0 411 9 It's complicated false Four silent mutations were introduced to eliminate EcoRI and PstI restriction enzyme sites. The EcoRI site was eliminated at base 39 with a G -> A mutation. PstI sites were eliminated at 240 and and 441 with T -> C mutations, and at 261 with a T -> G mutation. Mutation choices were selected to match codons with similar codon usage. true Jessica Harpole annotation1666362 1 G range1666362 1 39 44 annotation1666373 1 T range1666373 1 441 446 annotation1666363 1 T range1666363 1 240 245 annotation1666364 1 T range1666364 1 261 266 annotation1892252 1 PyrF range1892252 1 1 741 BBa_T9150_sequence 1 atgacgttaactgcttcatcttcttcccgcgctgttacaaattctcctgtggttgttgcccttgattatcataatcgtgatgacgcgctggcctttgtcgacaagatcgacccacgcgattgtcgtctgaaggtcggcaaagagatgtttacattgtttgggccacagtttgtgcgcgaacttcaacagcgtggttttgatatctttcttgacctgaaattccacgatatccccaacaccgcagcgcacgctgtcgctgcggcagctgacttaggcgtgtggatggtgaatgttcatgcctctggtggggcgcgtatgatgaccgcagcgcgtgaggcactggttccgtttggcaaagatgcaccgcttttgattgctgtgacagtgttgaccagcatggaagccagcgacctggtcgatcttggcatgacactgtcacccgcagattatgcagaacgtctggcggcactgacgcaaaaatgtggccttgatggtgtggtgtgttctgctcaggaagctgtgcgctttaaacaggtattcggtcaggagttcaaactggttacgccgggcattcgtccgcaggggagtgaagctggtgaccagcgccgcattatgacgccagaacaggcgttgtcggctggtgttgattatatggtgattggtcgcccggtaacgcaatcggtagatccagcgcagacgctgaaagcgatcaacgcctctttacagcggagtgcataataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z