BBa_Y00029 1 BBa_Y00029 S. pombe homolog of S.cerevisiae SGF29, recoded for expression in S.c. 2006-07-31T11:00:00Z 2015-05-08T01:14:53Z DNA 2.0 optimization of pombe genomic sequence Y00029 is S. pombe gene SPBC1921.07c [http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=protein&cmd=search&term=NP_596000.2] recoded for expression in S. cerevisiae. The pombe gene is the homolog of the cerevisiae SGF29 [http://db.yeastgenome.org/cgi-bin/locus.pl?locus=sgf29], a subunit of the ATP-independent chromatin remodelling complex SAGA. Deletion of this gene in S. cerevisiae results in a viable strain. Requirements for SGF29 in SAGA function are largely unexplored. Unlike many of the SAGA subunits, the pombe and the cerevisiae gene encode proteins of abour the same size (259 aa in cerevisiae and 244 in pombe). The gene has been recoded for expression in S. cerevisiae by DNA 2.0, although it's not clear that this recoding will be necessary for expresssion. The recoded gene is 78% identical to the original pombe gene (Identities = 568/723). false false _43_ 0 314 1 It's complicated false insured no biobrick sites in ORF during optimization false Natalie Kuldell annotation1892459 1 suffix range1892459 1 766 794 annotation1892458 1 prefix range1892458 1 1 30 BBa_Y00029_sequence 1 gtttcttcgaattcgcggccgcttctagagatggttagacctataaatgccgaagaagatgtaacctccatgtgggtcaaatttcacgaatcattaaatccgatacgttcttcacttatcaagcaagaagaatgttataaaaccgtcgacggggacgataatccaatagaggaaaggataaaagcctgtgatgctggtattcaaacatcagaagaacaaaaaaaggaattagaacacacaatgcaaagcctagaaatgatcattaatgtgttagaaaaagcaaacgagaaaccagtgattacgaacagtcctttgacaagaagcagacgtaatagaggaacttcttttacagctaacactgttaccttcactcccggtatgtcagttgccttcaagttaccatataccagacacaatgaaggtggggattggatacaatgcattattatcaaggtaactggagaaggtgcaaaacaaagattcgaagttcaagatccggaacccgatgacgatggcaacgctgggcagatctataaaaccacagcaaaccatcttattcagattcccgctaaggggacaccacttcctccgatttctccgaaaactaatgtgttagcacgttatccagaaaccactacgttttatagagctgaagtaattagaactcttcctgacggctcgtgtaaacttaggtttgaaggggaggaggaagttggcaaagaaaccgttgttgaaagacatttggttttagagtacaatggataatactagtagcggccgctgcaggaagaaac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z