BBa_Z0101 1 BBa_Z0101 T7 gene 0.3 2005-04-04T11:00:00Z 2015-05-08T01:14:54Z T7 genome reannotation Gene 0.3 is expressed at very high levels and protects T7 from various type I restriction systems by mimicking the shape of B DNA. Gp0.3 has been shown to bind the EcoKI restriction enzyme in a 2:1 complex and to displace the enzyme from its target DNA. Second site suppressors of 0.7-,2- infections map to gene 0.3 (Molineux, PC). Unknown why this is the case. false false _10_ 0 250 10 Not in stock false false T7.2 BBa_Z0101_sequence 1 atggctatgtctaacatgacttacaacaacgttttcgaccacgcttacgaaatgctgaaagaaaacatccgttatgatgacatccgtgacactgatgacctgcacgatgctattcacatggctgccgataatgcagttccgcactactacgctgacatctttagcgtaatggcaagtgagggcattgaccttgagttcgaagactctggtctgatgcctgacaccaaggacgtaatccgcatcctgcaagcgcgtatctatgagcaattaacgattgacctctgggaagacgcagaagacttgctcaatgaatacttggaggaagtcgaggagtacgaggaggatgaagagtaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z