BBa_Z0102 1 BBa_Z0102 T7 gene 0.4 2005-04-04T11:00:00Z 2015-05-08T01:14:54Z T7 reannotation open reading frame from wild-type T7 genome; not conserved; non-essential false false _10_ 0 250 10 Not in stock false false T7.2 BBa_Z0102_sequence 1 atgtctactaccaacgtgcaatacggtctgaccgctcaaactgtacttttctatagcgacatggtgcgctgtggctttaactggtcactcgcaatggcacagctcaaagaactgtacgaaaacaacaaggcaatagctttagaatctgctgagtga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z