BBa_Z0106 1 BBa_Z0106 T7.2 gene 0.7 2005-04-04T11:00:00Z 2015-05-08T01:14:54Z T7 genome reannotation Gene 0.7 codes for a protein that inactivates host-catalyzed transcription, it is also a serine-threonine protein kinase. The two activities are separable. Gp0.7 phosphorylates many host proteins, including ribosome components, ribonucleases III and E, and the β and β?? subunits of E. coli RNAP. The BR3 and Y49 strains contain the rpoC-E1158K mutation, which renders gp0.7 essential for phage growth. The mutation affects the region of β?? to which the T7 protein gp2 binds. Gene 0.7 is non-essential in wild-type hosts and is actually detrimental when T7 is grown at 30˚C in rich media. Early T7 RNA and protein synthesis is prolonged after infection by gp0.7 mutants. However, phage growth at elevated temperatures or in minimal media, or in cells harboring the Col Ib plasmid renders gene 0.7 essential. The processes underlying the conditional necessity for gp0.7 function have not been determined. The E. coli C promoter -35 region is located on the 3' end of the coding sequence. Removing the downstream region will probably be sufficient to delete functioning of the promoter. false false _10_ 0 250 10 Not in stock false false T7.2 annotation1476456 1 -45 region of C promoter range1476456 1 1049 1049 annotation1476455 1 -35 region of C promoter range1476455 1 1058 1062 annotation1883644 1 added BsiWI range1883644 1 1081 1086 BBa_Z0106_sequence 1 atgaacattaccgacatcatgaacgctatcgacgcaatcaaagcactgccaatctgtgaacttgacaagcgtcaaggtatgcttatcgacttactggtcgagatggtcaacagcgagacgtgtgatggcgagctaaccgaactaaatcaggcacttgagcatcaagattggtggactaccttgaagtgtctcacggctgacgcagggttcaagatgctcggtaatggtcacttctcggctgcttatagtcacccgctgctacctaacagagtgattaaggtgggctttaagaaagaggattcaggcgcagcctataccgcattctgccgcatgtatcagggtcgtcctggtatccctaacgtctacgatgtacagcgccacgctggatgctatacggtggtacttgacgcacttaaggattgcgagcgtttcaacaatgatgcccattataaatacgctgagattgcaagcgacatcattgattgcaattcggatgagcatgatgagttaactggatgggatggtgagtttgttgaaacttgtaaactaatccgcaagttctttgagggcatcgcctcattcgacatgcatagcgggaacatcatgttctcaaatggagacgtaccatacatcaccgacccggtatcattctcgcagaagaaagacggtggcgcattcagcatcgaccctgaggaactcatcaaggaagtcgaggaagtcgcacgacagaaagaaattgaccgcgctaaggcccgtaaagaacgtcacgaggggcgcttagaggcacgcagattcaaacgtcgcaaccgcaaggcacgtaaagcacacaaagctaagcgcgaaagaatgcttgctgcgtggcgatgggctgaacgtcaagaacggcgtaaccatgaggtagctgtagatgtactaggaagaaccaataacgctatgctctgggtcaacatgttctctggggactttaaggcgcttgaggaacgaatcgcgctgcactggcgtaatgctgaccggatggctatcgctaatggtcttacgctcaacattgataagcaacttgacgcaatgttaatgggctgacgtacg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z