BBa_Z0111 1 BBa_Z0111 T7 gene 1.5 2005-04-04T11:00:00Z 2015-05-08T01:14:54Z T7 genome reannotation open reading frame for gene 1.5 from wild-type T7 genome false false _10_ 0 250 10 Not in stock false false T7.2 annotation1476496 1 first three bases of phi1.6 23bp consensus sequence range1476496 1 88 90 BBa_Z0111_sequence 1 atgatgtacttaatgccattactcatcgtcattgtaggatgccttgcgctccactgtagcgatgatgatatgccagatggtcacgcttaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z