BBa_Z0116 1 BBa_Z0116 T7.2 gene 2 2006-04-11T11:00:00Z 2015-05-08T01:14:54Z Gp2 binds to and is an inhibitor of E. coli RNAP but in K-12 or B strains the defects due to a lack of gene 2 activity are reduced DNA replication and premature breakdown of replicating DNA, specifically at the left genome end where the major E. coli promoters are found. false false _10_ 0 64 11 Not in stock false false Sri Kosuri annotation1883670 1 added ecoRI range1883670 1 196 201 annotation1881250 1 tca...aat->agc...aat range1881250 1 4 39 BBa_Z0116_sequence 1 atgagcaatgtaaataccggatccttaagcgtagataataagaagttttgggctaccgtagagtcctcggagcattccttcgaggttccaatctacgctgagaccctagacgaagctctggagttagccgaatggcaatacgttccggctggctttgaggttactcgtgtgcgtccttgtgtagcaccgaagtaagaattc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z