BBa_Z0119 1 BBa_Z0119 T7.2 gene 3.5 2006-04-24T11:00:00Z 2015-05-08T01:14:54Z Gene 3.5 codes for lysozyme, which is actually not a lysozyme but an N-acetylmuramyl-L-alanine amidase. The most important functions of lysozyme are also not in cell lysis but lie in controlling initiation and termination by T7 RNAP, which in turn affect DNA replication and packaging. false false _11_ 0 64 11 Not in stock false false Sri Kosuri annotation1849938 1 S3: possible promoter range1849938 1 110 173 annotation1860957 1 S3 -10 region range1860957 1 147 152 annotation1862116 1 ggt???>GGC range1862116 1 121 123 annotation1862117 1 ttt->TTC range1862117 1 145 147 annotation1860956 1 S3 -35 region range1860956 1 123 127 BBa_Z0119_sequence 1 atggctcgtgtacagtttaaacaacgtgaatctactgacgcaatctttgttcactgctcggctaccaagccaagtcagaatgttggtgtccgtgagattcgccagtggcacaaagagcagggctggctcgatgtgggataccacttcatcatcaagcgagacggtactgtggaggcaggacgagatgagatggctgtaggctctcacgctaagggttacaaccacaactctatcggcgtctgccttgttggtggtatcgacgataaaggtaagttcgacgctaactttacgccagcccaaatgcaatcccttcgctcactgcttgtcacactgctggctaagtacgaaggcgctgtgcttcgcgcccatcatgaggtggcgccgaaggcttgcccttcgttcgaccttaagcgttggtgggagaagaacgaactggtcacttctgaccgtggataagatct igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z