BBa_Z0124 1 BBa_Z0124 T7.2 gene 7.3 2006-04-25T11:00:00Z 2015-05-08T01:14:54Z Gene 7 was originally defined by mutations that mapped between genes 6 and 8 but was subsequently shown to be two genes, 7 and 7.3. Gp7.3 is a tail protein, present in ~30 copies per particle, that is essential for infectivity though not particle formation. false false _11_ 0 64 11 Not in stock false false Sri Kosuri annotation1855232 1 possible promoter site? range1855232 1 168 168 annotation1883626 1 att->ATC range1883626 1 295 297 annotation1883678 1 added bstEII range1883678 1 301 307 BBa_Z0124_sequence 1 atgggtaagaaagttaagaaggccgtgaagaaagtcaccaagtccgttaagaaagtcgttaaggaaggggctcgtccggttaaacaggttgctggcggtctagctggtctggctggtggtactggtgaagcacagatggtggaagtaccacaagctgccgcacagattgttgacgtacctgagaaagaggtttccactgaggacgaagcacagacagaaagcggacgcaagaaagctcgtgctggcggtaagaaatccttgagtgtagcccgtagctccggtggcggtatcaacatctaaggtcacc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z