BBa_Z0252 1 BBa_Z0252 T7 weak binding and processivity 2005-04-04T11:00:00Z 2015-05-08T01:14:55Z T7 Promoter for T7 RNA polymerase false false _10_ 0 250 10 Not in stock false false T7.2 annotation1476344 1 tga -> acg mutation from consensus range1476344 1 10 12 annotation1476345 1 t -> a mutation from consensus range1476345 1 21 21 annotation1476343 1 23bp conserved region range1476343 1 6 28 BBa_Z0252_sequence 1 ataattaattgaactcactaaagggagaccacagc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z