BBa_Z0261 1 BBa_Z0261 Strong T7.2 RBS 2006-05-15T11:00:00Z 2015-05-08T01:14:55Z Sequence comes from the natural gene 5 RBS. Using gene 5 as a strong RBS is from initial results from experiments characterizing all natural T7 RBSs. false false _11_10_ 0 64 10 Not in stock false false Sriram Kosuri BBa_Z0261_sequence 1 aatcaataggagaaatcaat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z