BBa_Z0271 1 BBa_Z0271 T7.2 TE transcriptional terminator 2006-05-15T11:00:00Z 2015-05-08T01:14:55Z Takes 6bp ahead of the expected start of the stem loop, and 3bp after the expected termination site (11bp after end of stem loop). Causes termination by E. coli RNA polymerase (but not T7 RNA polymerase). false false _11_10_ 0 64 10 Not in stock false false Sriram Kosuri annotation1862801 1 TE expected stem loop range1862801 1 7 26 BBa_Z0271_sequence 1 cacactggctcaccttcgggtgggcctttctgcgttt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z