BBa_B0025 1 BBa_B0025 double terminator (B0015), reversed 2003-12-02T12:00:00Z 2015-08-31T04:07:20Z -- No description -- false true _1_ 0 24 7 In stock false true Caitlin Conboy annotation369703 1 B0010 range369703 1 50 129 annotation369702 1 B0012 range369702 1 1 41 BBa_I12007 1 Prm + Modified lambda Prm promoter (OR-3 obliterated) 2004-07-14T11:00:00Z 2015-08-31T04:07:31Z Shih and Gussin (1983) Released HQ 2013 Lambda Prm promoter modified to be activated but not repressed by the lambda repressor (cI) false true _3_ 0 103 7 In stock false In wild type lambda phage, the OR3 site (-27 to -11) reads "tatcccttgcggtgata" on the sense strand of DNA. To prevent lambda repressor (cI) from binding to this site, the 4th through 10th nt of OR3 were replaced by the 7 nt between OR2 and OR1, "aaatagt" (-57 to -51), which in effect mutates 5 nt of the promoter. These nt were chosen to be about halfway between the -10 and -35 boxes of the promoter. Furthermore, since these nt already act as a spacer in wild-type phage, it is hoped they will not create undesired interactions. true Hans annotation937705 1 -10 range937705 1 71 76 annotation937702 1 OR2 range937702 1 33 49 annotation937703 1 -35 range937703 1 48 53 annotation937701 1 OR1 range937701 1 9 25 annotation937704 1 mutate to obliterate OR3 range937704 1 59 65 BBa_Z52935 1 BBa_Z52935 protein generator for enzyme 2007-05-24T11:00:00Z 2015-05-08T01:14:55Z Protein generator for part BBa_Z52934 generates the enzyme X which is used on said substrate false false _1_ 0 612 1 Not in stock false want repressible promoter weak terminator false Melissa Li component1933686 1 BBa_B0025 component1933675 1 BBa_B0031 component1933683 1 BBa_I12007 component1933677 1 BBa_Z52934 annotation1933677 1 BBa_Z52934 range1933677 1 21 854 annotation1933686 1 BBa_B0025 range1933686 1 953 1081 annotation1933683 1 BBa_I12007 range1933683 1 863 944 annotation1933675 1 BBa_B0031 range1933675 1 1 14 BBa_B0031 1 BBa_B0031 RBS.2 (weak) -- derivative of BBa_0030 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Medium RBS based on Ron Weiss thesis. Strength considered relative to <bb_part>BBa_B0030</bb_part>, <bb_part>BBa_B0032</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _41_44_48_46_1_ 0 24 7 In stock false <P> <P>Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;RBS-1&quot; in figure 4-14 of thesis). <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. <P> Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Cho</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23316 1 conserved range23316 1 7 10 BBa_Z52934 1 BBa_Z52934 vdh 2007-05-24T11:00:00Z 2015-05-08T01:14:55Z GenBank AJ536325 one of five genes needed for conversion of chemical substrate to its commercially usable form. Origin is from Pseudomonas aeruginosa. Submitted to GenBank 2003 false true _1_ 0 612 1 Not in stock false changed the final codon from TGA to TAA to match biobrick standards false Melissa Li annotation1933704 1 start codon range1933704 1 1 3 BBa_I12007_sequence 1 gcaaccattatcaccgccagaggtaaaatagtcaacacgcacggtgttagatatttataaatagtggtgatagatttaacgt BBa_Z52935_sequence 1 tcacacaggaaacctactagatgagcaactacgaaggtcgctggacaacggtcaaggtcgaaatcgaagacggcattgcctgggtcattctcaatcgtccggaaaaacgcaacgccatgagcccaaccctgaaccgggaaatgatcgacgtgctggaaaccctggaacaggacccggccgctggtgtgctggtgctgaccggcgccggcgaggcctggaccgccggcatggacctcaaggaatacttccgcgaggtggatgccgggccggagatccttcaggagaaaatccgccgcgaagcctcccagtggcagtggaaactgctgcgcatgtacgccaagccgaccatcgccatggtcaacggctggtgcttcggtggcggcttcagcccgctggtggcgtgcgatctggcgatctgcgccgacgaggccaccttcggcctgtctgaaatcaactggggcatcccgccgggcaacctggtgagcaaggccatggccgacaccgtgggccatcgccagtcgctgtactacatcatgaccggcaagactttcggcgggcagaaagccgccgaaatgggcctggtcaacgacagcgtgcccctggctcgattgcgtgaggtgaccattgagctggcgcgcaacctgctggagaaaaacccggtggtgctgcgtgccgccaagcatggcttcaagcgttgccgcgagctgacctgggagcagaacgaagactacctgtacgccaagctcgatcagtcgcgcctgttggacaccgaaggcggccgcgagcagggcatgaagcagtttctcgacgacaagagcatcaagcccggcctgcaggcgtataaacgctaataatactagaggcaaccattatcaccgccagaggtaaaatagtcaacacgcacggtgttagatatttataaatagtggtgatagatttaacgttactagagtataaacgcagaaaggcccacccgaaggtgagccagtgtgactctagtagagagcgttcaccgacaaacaacagataaaacgaaaggcccagtctttcgactgagcctttcgttttatttgatgcctgg BBa_Z52934_sequence 1 atgagcaactacgaaggtcgctggacaacggtcaaggtcgaaatcgaagacggcattgcctgggtcattctcaatcgtccggaaaaacgcaacgccatgagcccaaccctgaaccgggaaatgatcgacgtgctggaaaccctggaacaggacccggccgctggtgtgctggtgctgaccggcgccggcgaggcctggaccgccggcatggacctcaaggaatacttccgcgaggtggatgccgggccggagatccttcaggagaaaatccgccgcgaagcctcccagtggcagtggaaactgctgcgcatgtacgccaagccgaccatcgccatggtcaacggctggtgcttcggtggcggcttcagcccgctggtggcgtgcgatctggcgatctgcgccgacgaggccaccttcggcctgtctgaaatcaactggggcatcccgccgggcaacctggtgagcaaggccatggccgacaccgtgggccatcgccagtcgctgtactacatcatgaccggcaagactttcggcgggcagaaagccgccgaaatgggcctggtcaacgacagcgtgcccctggctcgattgcgtgaggtgaccattgagctggcgcgcaacctgctggagaaaaacccggtggtgctgcgtgccgccaagcatggcttcaagcgttgccgcgagctgacctgggagcagaacgaagactacctgtacgccaagctcgatcagtcgcgcctgttggacaccgaaggcggccgcgagcagggcatgaagcagtttctcgacgacaagagcatcaagcccggcctgcaggcgtataaacgctaataa BBa_B0031_sequence 1 tcacacaggaaacc BBa_B0025_sequence 1 tataaacgcagaaaggcccacccgaaggtgagccagtgtgactctagtagagagcgttcaccgacaaacaacagataaaacgaaaggcccagtctttcgactgagcctttcgttttatttgatgcctgg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z