spacer

BBa_B0040 Version 1

Component

Source:
http://parts.igem.org/Part:BBa_B0040
Generated By: https://synbiohub.org/public/igem/igem2sbol/1
Created by: Vinay S. Mahajan, Brian Chow, Peter Carr
Date created: 2003-01-31 12:00:00
Date modified: 2015-08-31 04:07:20

Spacer.1 (generic)



Types
DnaRegion

Roles
sequence_feature

DNA

Sequences BBa_B0040_sequence (Version 1)

Description

Generic spacer for ensuring a 70 bp distance between the end of the suffix of the BioBrick part containing the double terminator and the prefix of the BioBrick part containing the promoter of the new gene. Please, use the AlignX function of Vector NT to check for homology with the components in your plasmid before using this spacer.



Notes

The size of the spacer was choosed to meet the minimum length of a sequence that can be queried using the BLAST search engine. However, subsequences of it can be used to design shorter spacers. The sequence was selected from many more sequences randomly generated using the Random DNA Generator engine; the GC% parameter used as input was 50%. The sequences were selected based on the following constraints listed in their order of importance: the absence of any putative promoter regions, a low degree of homology with the Elowitz plasmid (whose components are widely used in our designs), no homology with other E.coli sequences as shown by BLASTN search results and the presence of a number of TAA stop codons. The second constraint was the most stringent leading to the elimination of most sequences.

DE made the following changes to the original sequence in order to add stop codons in the -3 frame and more in the +2 frame (note, not all of these stop codons are UAA. Thus, if used in an organism that inserts an amino acid @ UGA or UAG the obvious will occur):
T->A @ 85
T->A @ 42
C->T @ 79
A->T @ 64
A->T @ 31
T->A @ 34
C->A @ 37
Also, note that the above changes further reduce (the already very weak) homology to current NCBI-stored sequences.

In the process of selecting the best sequence it appeared that a good alternative sequence for a spacer would be: AGGTTCTGATATGTAACTGTGCCCAATGTCGTTAGTGACGCATACCTCTTAAGAGGCCACTGTCCTAACA. The sequence contains no putative promoters and shows moderate homology with the 5' end of the Ampicillin resistance gene. However a strong promoter sequence starts 12 bp downstream of this sequence, and therefore the sequence presented above was preferred.

The sequence is compatible (does not show significant homology) with the components in the Elowitz repressilator plasmid.

Source

Randomly generated and optimized for several parameters (see Design notes).

Sequence Annotation Location Component / Role(s)
Spacer-1
BBa_B0040
1,70
1,70
feature/misc sequence_feature
feature/BioBrick engineered_region
igem#experience Works  
igem#partStatus Released HQ 2013  
igem#sampleStatus In stock  
igem#status Available  
synbiohub#ownedBy user/james  
synbiohub#ownedBy user/myers  
synbiohub#topLevel BBa_B0040/1