Types | DnaRegion
|
Roles | Coding
CDS
|
Sequences | BBa_I716212_sequence (Version 1)
|
Description
weakened version of Cre (has a GTG start codon) because we want a lower copy
Notes
PCR sil05 and G00101 on pBca9145-Bca1117 (PCR product is 1147bp, BglII/XhoI 1047 bp)
Sub into pBca9145-Bca1089 (BglII/XhoI, 2063+696, L)
Product is pBca9145-I716212 (GTG start)
sil05 Forward BglII Cre with GTG start ctagcAGATCTgtgtccaatttactgaccgtac
G00101 Reverse Sequencing of pSB1A* plasmids attaccgcctttgagtgagc
Source
PCR sil05 and G00101 on pBca9145-Bca1117 (PCR product is 1147bp, BglII/XhoI 1047 bp)
Sub into pBca9145-Bca1089 (BglII/XhoI, 2063+696, L)
Product is pBca9145-I716212 (GTG start)
sil05 Forward BglII Cre with GTG start ctagcAGATCTgtgtccaatttactgaccgtac
G00101 Reverse Sequencing of pSB1A* plasmids attaccgcctttgagtgagc