Types | DnaRegion
|
Roles | Plasmid_Backbone
plasmid_vector
|
Sequences | BBa_J99000_sequence (Version 1)
|
Description
This vector has the conditional origin of replication oriVR6K and can be maintained only in strains expressing the pir gene. It carries the origin of transfer of RP4 and can thus be used in conjugation assays in a donor cell expressing the RP4 conjugation machinery. It also carries the attP recombination site of the lambda phage in order to permit site specific integration at the attB site of E.coli chromosome mediated by the lambda integrase (Valens et al., 2004).
Notes
attP recombination site of the lambda phage was PCR amplified with oligos
5'-TGGAGCTCAAATCAAATAATGATTTTATTT-3' and 5'-GCTGGAGCTCCATGGTACGCGTGCTAGAGGCA-3', and cloned at the SacI site of pSW23T (Demarre et al., 2005). The multiple cloning site was then replaced with the BioBrick strandard restriction sites through inverse PCR with oligos 'GCTTCTAGAGTACTAGTAGCGGCCGCTGCAGGCGGTGGAGCTCAAATCAAATAATG' and 'AGTACTCTAGAAGCGGCCGCGAATTCTATCAAGCTTATCGATACCGTCGACG'
Source
This plasmid was constructed from pSW23T (Demarre et al., 2005)