BBa_K091103
BBa_K091103 Version 1 Component
This part has been discontinued.
Please consider using BBa_I715052 as a replacement.
Source:
Generated By: https://synbiohub.org/public/igem/igem2sbol/1
Created by: Malcolm Campbell
Date created: 2008-06-09 11:00:00
Date modified: 2015-05-08 01:08:37
Duplicate of BBa_I715052
| Types | DnaRegion |
| Roles | Regulatory promoter |
| Sequences | BBa_K091103_sequence (Version 1) |
Description
Anti-terminators occur in nature to regulate transcription of a variety of genes, such as bacterial operons and phage genes (Nudler et al., 2002). Transcriptional termination is caused by the formation of an RNA stem-loop structure, the terminator, that forces RNA polymerase to detach from the mRNA (Figure 4 B). An anti-terminator is another RNA stem-loop structure that precedes and inhibits the formation of the terminator and its stem-loop structure, thereby preventing termination (Figure 4 A) (Nudler et al., 2002). Although the anti-terminator is also a stem-loop structure, it does not terminate transcription. If an anti-terminator forms, a terminator cannot form, and transcription continues. This transcriptional attenuation mechanism allows for regulation of transcription by either selectively terminating transcription prematurely or by allowing it to proceed. The choice between transcriptional termination or anti-termination will change what is transcribed and modify gene regulation in response to environmental conditions.The tryptophan operon in E. coli, trp, is regulated using an anti-terminator and encodes for genes that synthesize the amino acid tryptophan (Figure 6). The first important step in the transcription of the operon takes place at the leader peptide sequence, trpL. In bacteria, translation can begin while transcription is still under way. In this particular case, it is critical that transcription and translation are synchronized, such that a specific distance between the RNA polymerase and ribosome is set. RNA polymerase begins transcribing the mRNA until it produces a stem-loop structure which causes the polymerase to pause, denoted by the yellow region. The pause by RNA polymerase gives the ribosome time to start translating the trpL mRNA sequence into a short, non-functional leader peptide and to catch up with RNA polymerase. Once the ribosome has caught up to the RNA polymerase, the secondary structure that caused the RNA polymerase to pause is altered, and RNA polymerase continues transcription. This pausing of RNA polymerase causes transcription and translation to become coupled and to happen in synchrony (Landick et al., 1987).
Before the leader peptide???s stop codon, and near the beginning of the anti-terminator sequence, are two sequential codons that code for tryptophan, shown in orange. If tryptophan concentrations are low, the ribosome will pause at these two tryptophan codons until tRNAs carrying tryptophan arrive. Meanwhile, RNA polymerase moves further downstream, elongating the mRNA molecule. The elongated mRNA forms an anti-terminator stem-loop structure which prevents the formation of a terminator stem-loop (Figure 5 B). The RNA polymerase continues mRNA elongation, the ribosome resumes once two tRNATrp arrive and the entire trp operon is transcribed and translated (Figure 6) (Landick et al., 1987).
Conversely, when tryptophan is abundant, the ribosome does not pause at the pair of tryptophan codons because tRNATrp are plentiful; translation continues unabated, and RNA polymerase does not distance itself from the ribosome (Figure 5 A). As the ribosome advances, it prevents the formation of the anti-terminator stem-loop structure through steric interactions. The lack of an anti-terminator structure leads to the formation of a new stem-loop structure, the transcriptional terminator, and causes the attenuation of the transcription. In this way, E. coli will not transcribe the trp operon unless it needs more tryptophan. The ribosome pauses temporarily only when there is a shortage of tryptophan, triggering the eventual synthesis of enzymes that will produce more tryptophan (Landick et al., 1987).
Notes
None at this time.Source
It was amplified by PCR using these primers:DNA sequence of forward primer:
5' GCATGAATTCGCGGCCGCTTCTAGACGTAAAAAGGGTATCGACAATGAAA 3'
DNA sequence or reverse primer:
5' GCATCTGCAGCGGCCGCAACTAGTAAAAAAAAGCCCGCTCATTAGG 3'
The primers contain the BioBrick ends, as well as 4 extra bases to facilitate restriction enzyme digestion and subsequent cloning.
Template was genomic DNA from JM109.
| Sequence Annotation | Location | Component / Role(s) |
| rbs start Double Trp Codon stop Pause Stem-Loop Anti-terminator Transcriptional Terminator | 5,13 20,22 47,52 62,64 5,36 67,113 106,127 | ribosome_entry_site feature/rbs start_codon feature/start feature/misc sequence_feature feature/stop stop_codon feature/stem_loop stem_loop feature/stem_loop stem_loop stem_loop feature/stem_loop |