Types | DnaRegion
|
Roles | Coding
CDS
|
Sequences | BBa_K129005_sequence (Version 1)
|
Description
LamB tolerates insertions of long heterologous peptides at a permissive loop (between structural codons 153 and 154) exposed to the external medium without a loss of function.CP (Gly-Cys-Gly-Cys-
Pro-Cys-Gly-Cys-Gly), employed in LamB and called LamB_CP. Cp was previously found as
cysteine and histidine residues for Cd21 binding (29). CP was
further characterized and employed for display on the E. coli
surface.
Notes
To make HP_LamB GATCCAGCTGGTCATCATCCACACGGTGCT is inserted in LamB protein at 153
Source
GATCCAGCAGGCTGCGGTTGTCCATGCGGTTGTGGCGCT encodes the N-Ala-Gly-Cys-Gly-Cys-Pro-Cys-Gly-Cys-Gly-Ala-C sequence
inserted in LamB-153 residue because permissive loop (between structural codons 153and 154) can be exposed to the external medium without a loss of function.