Source:
Generated By: https://synbiohub.org/public/igem/igem2sbol/1
Created by: Mona Dotzler
Date created: 2014-10-02 11:00:00
Date modified: 2015-06-01 12:53:36
Laminin-derived peptide binding to NADH Oxidase of S. pneumoniae
| Types | DnaRegion |
| Roles | CDS Coding |
| Sequences | BBa_K1351003_sequence (Version 1) |
Description
Short peptide of 9 amino acids corresponding to amino acids 661 to 668 of the human protein Laminin (subunit alpha-5, UniProt O15230). It has been shown to bind to NADH oxidase (NOX) of Streptococcus pneumoniae and inhibit bacterial binding to human A549 cells (Muchnik et. al., 2013). Displayed on the surface of Bacillus subtilis, it should enable B. subtilis to bind specifically to S. pneumoniae.This part was generated in a modified version of RFC25, where a strong Shine Dalgarno Sequence (SD) is included, and has the following prefix and suffix:
{|
|prefix with EcoRI, NotI, XbaI, SD and NgoMIV:
|GAATTCGCGGCCGCTTCTAGAGTAAGGAGGAGCCGGC
|-
|suffix with AgeI, SpeI, NotI and PstI:
|ACCGGTTAATACTAGTAGCGGCCGCCTGCAG
|}
Sites of restriction enzymes generating compatible overhangs have the same color:
EcoRI and PstI in blue, NotI in green, XbaI and SpeI in red, NgoMIV and AgeI in orange. Shine-Dalgarno sequence and stop codons are underlined.
Notes
For generation of the part's nucleotide sequence, the amino acid sequence of the peptide (Muchnik et. al., 2013) was reverse transcribed with regard to the codon usage of Bacillus subtilis.Oligos were designed as precut by EcoRI and PstI to shorten the synthesized fragments and to simplify the cloning into pSB1C3.
Source
The part was generated by annealing of artificially synthesized oligonucletides:L5P_ENX_SD_Ngo_precutEP_fwd: AATTCgcggccgctTCTAGAgtaaggaggaaGCCGGCATG TGTCAAGAATGTTCACCGGGATTT ACCGGTtaatACTAGTagcggccgCTGCA
L5P_SNP_Age_precutEP_rev: GcggccgctACTAGTattaACCGGT AAATCCCGGTGAACATTCTTGACA CATGCCGGCttcctccttacTCTAGAagcggccgcG