Source:
Generated By: https://synbiohub.org/public/igem/igem2sbol/1
Created by: Mona Dotzler
Date created: 2014-10-03 11:00:00
Date modified: 2015-06-01 12:54:45
CWB domain of B. subtilis major autolysin LytC
| Types | DnaRegion |
| Roles | CDS Coding |
| Sequences | BBa_K1351006_sequence (Version 1) |
Description
Cell wall binding domain and signal peptide (amino acids 1 to 333) of Bacillus subtilis major autolysin LytC (Uniprot Q02114). This domain has been used for displaying heterologous proteins on the cell surface of B. subtilis (Tsuchiya et. al., 1999). Used in the BaKillus project to display pathogen-specific peptides by C-terminal fusions to mediate adhesion of B. subtlis to pathogens.Notes
Due to the N-terminal signal peptide, this part allows only C-terminal fusions of proteins to be displayed on the cell surface.The CWB domain of LytC consists of three N‐terminal type II cell wall‐binding motifs, ranging from position 30 to 318. To minimize possible effects of a translational fusion to the CWB domain, the part includes the downstream unstructered region until position 333. An additional linker can be inserted to allow more structural flexibilty.
Source
This part was generated by amplification from B. subtilis W168 gDNA with the primers listed below, followed by digestion with EcoRI and PstI and ligation into pSB1C3.LytC_ENX_SD_Ngo_fwd: gatcGAATTCgcggccgctTCTAGAgtaaggaggaaGCCGGC TTGCGTTCTTATATAAAAGTCCTAACAATGTG
LytC_333_SNP_Age_rev: gatcCTGCAGcggccgctACTAGTattaACCGGT TGAATCTTGATCACCGTGACCC
| Sequence Annotation | Location | Component / Role(s) |
| signal peptide CWB repeat CWB repeat CWB repeat | 1,75 90,386 387,668 669,956 | feature/misc sequence_feature CDS feature/cds CDS feature/cds CDS feature/cds |