Source:
Generated By: https://synbiohub.org/public/igem/igem2sbol/1
Created by: Mona Dotzler
Date created: 2014-10-04 11:00:00
Date modified: 2015-06-01 12:54:58
CWB domain of B. subtilis minor autolysin LytE
| Types | DnaRegion |
| Roles | Coding CDS |
| Sequences | BBa_K1351007_sequence (Version 1) |
Description
Cell wall binding domain and signal peptide (amino acids 1 to 207) of Bacillus subtilis minor autolysin LytE (probable peptidoglycan endopeptidase, Uniprot P54421). This domain has been used for displaying beta-lactamase on the cell surface of B. subtilis (Chen et. al., 2008). Used in the BaKillus project to display pathogen-specific peptides to mediate adhesion of B. subtilis to pathogens.This part was generated in a modified version of RFC25, where a strong Shine Dalgarno Sequence (SD) is included, and has the following prefix and suffix:
{|
|prefix with EcoRI, NotI, XbaI, SD and NgoMIV:
|GAATTCGCGGCCGCTTCTAGAGTAAGGAGGAGCCGGC
|-
|suffix with AgeI, SpeI, NotI and PstI:
|ACCGGTTAATACTAGTAGCGGCCGCCTGCAG
|}
Sites of restriction enzymes generating compatible overhangs have the same color:
EcoRI and PstI in blue, NotI in green, XbaI and SpeI in red, NgoMIV and AgeI in orange. Shine-Dalgarno sequence and stop codons are underlined.
Notes
Due to the N-terminal signal peptide, this part allows only C-terminal fusions of proteins to be displayed on the cell surface.The CWB domain of LytE consists of three N‐terminal LysM cell wall‐binding motifs, ranging from amino acid 28 to 193. To minimize possible effects of a translational fusion to the CWB domain, the part includes the downstream unstructered region until amino acid 207. An additional linker can be inserted to allow more structural flexibilty.
Source
This part was generated by amplification from B. subtilis W168 gDNA with the primers listed below, followed by digestion with EcoRI and PstI and ligation into pSB1C3.LytE_ENX_SD_Ngo_fwd: gatcGAATTCgcggccgctTCTAGAgtaaggaggaaGCCGGC ATGAAAAAGCAAATCATTACAGCTACGACAGC
LytE_207_SNP_Age_rev: gatcCTGCAGcggccgctACTAGTattaACCGGT CGATGAAGATGAAGCAGGTTTTGAGC
A SpeI site was removed by changing T to C at position 399 without altering the protein sequence by fusion PCR with the following mutagenesis primers:
LytE_SpeI399mut_fwd: GTCCTGAAACTGAAAGGTTCAACcAGTTCAAGCAGCTCCAGCTCATCAAAAG
LytE_SpeI399mut_rev: CTTTTGATGAGCTGGAGCTGCTTGAACTgGTTGAACCTTTCAGTTTCAGGAC