Source:
Generated By: https://synbiohub.org/public/igem/igem2sbol/1
Created by: Mona Dotzler
Date created: 2014-10-04 11:00:00
Date modified: 2015-06-01 12:55:21
Cell wall-anchoring domain of B. subtilis endonuclease YhcR
| Types | DnaRegion |
| Roles | CDS Coding |
| Sequences | BBa_K1351010_sequence (Version 1) |
Description
Cell wall-anchoring domain (amino acids 1086 to 1217) of Bacillus subtilis endonuclease YhcR (UniProt P54602). YhcR is secreted and covalently anchored to the petidoglycan wall by the sortase YhcS.A YhcR-based surface display system has been shown to covalently anchor heterologous proteins to the B. subtilis cell wall (Liew et. al., 2012). It was used in the BaKillus project to display pathogen-specific peptides and mediate adhesion of B. subtlis to pathogens.
It consists of four components: the sortase substrate with a signal peptide (BBa_K1351008), a linker (BBa_K1351009) and a cell wall-anchoring domain (this part) as well as the sortase YhcS itself (BBa_K1351011), whose overexpression increases the efficiency of the surface display.
This part was generated in a modified version of RFC25, where a strong Shine Dalgarno Sequence (SD) is included, and has the following prefix and suffix:
{|
|prefix with EcoRI, NotI, XbaI, SD and NgoMIV:
|GAATTCGCGGCCGCTTCTAGAGTAAGGAGGAGCCGGC
|-
|suffix with AgeI, SpeI, NotI and PstI:
|ACCGGTTAATACTAGTAGCGGCCGCCTGCAG
|}
Sites of restriction enzymes generating compatible overhangs have the same color:
EcoRI and PstI in blue, NotI in green, XbaI and SpeI in red, NgoMIV and AgeI in orange. Shine-Dalgarno sequence and stop codons are underlined.
Notes
noneSource
This part was generated by amplification from B. subtilis W168 gDNA with the primers listed below, followed by digestion with EcoRI and PstI and ligation into pSB1C3.CWAD_YhcR_ ENX_SD_Ngo_fwd: gatcGAATTCgcggccgctTCTAGAgtaaggaggaaGCCGGCATG GCTGAAGCCAGTGATATTGAAGACCC
CWAD_YhcR_SNP_Age_rev: gatcCTGCAGcggccgctACTAGTattaACCGGT TCACGTTCTGGAGGCGCTC
| Sequence Annotation | Location | Component / Role(s) |
| LPDTS sorting signal | 292,306 | sequence_feature feature/misc |