Source:
Generated By: https://synbiohub.org/public/igem/igem2sbol/1
Created by: Judith Heckmann
Date created: 2014-10-05 11:00:00
Date modified: 2015-06-01 08:13:27
PcomAB, a CSP inducible promoter derived from Streptococcus pneumoniae
| Types | DnaRegion |
| Roles | promoter Regulatory |
| Sequences | BBa_K1351025_sequence (Version 1) |
Description
CSP-depending promoter of Streptococcus pneumoniae.This part was generated in a modified version of RFC25, where a strong Shine Dalgarno Sequence (SD) is included, and has the following prefix and suffix:
{|
|prefix with EcoRI, NotI, XbaI, SD and NgoMIV:
|GAATTCCGCGGCCGCTTCTAGATAAGGAGGAGCCGGC
|-
|suffix with AgeI, SpeI, NotI and PstI:
|ACCGGTTAATACTAGTAGCGGCCGCTGCAG
|}
Sites of restriction enzymes generating compatible overhangs have the same color:
EcoRI and PstI in blue, NotI in green, XbaI and SpeI in red, NgoMIV and AgeI in orange. Shine-Dalgarno sequence and stop codons are underlined.
Notes
noneSource
gDNA from Streptococcus pneumoniae R6| Sequence Annotation | Location | Component / Role(s) |
| ComE binding site Left ComE binding site Right | 62,70 83,91 | non_covalent_binding_site feature/binding feature/binding non_covalent_binding_site |