BBa_K1351029

BBa_K1351029 Version 1

Component

Source:
http://parts.igem.org/Part:BBa_K1351029
Generated By: https://synbiohub.org/public/igem/igem2sbol/1
Created by: Florian Riemer
Date created: 2014-10-05 11:00:00
Date modified: 2015-06-01 08:10:03

LMU Bacillus RBS collection 2



Types
DnaRegion

Roles
ribosome_entry_site

RBS

Sequences BBa_K1351029_sequence (Version 1)

Description

"This part was generated in a modified version of RFC25, and has the following prefix and suffix:

{|
|prefix with EcoRI, NotI, XbaI, SD and NgoMIV:
|GAATTCGCGGCCGCTTCTAGATGGCCGGC
|-
|suffix with AgeI, SpeI, NotI and PstI:
|ACCGGTTAATACTAGTAGCGGCCGCTGCAG
|}
Sites of restriction enzymes generating compatible overhangs have the same color:

EcoRI and PstI in blue, NotI in green, XbaI and SpeI in red, NgoMIV and AgeI in orange. Stop codons are underlined."

Notes

The LMU Bacillus RBS collection is based on a wobble-library with the sequence ARRRRRRGATA and the theoretical translation initiation rates of the RBS in this library, calculated by the salis lab's RBS calculator (https://salis.psu.edu/software/). The 7 RBS submitted as BioBricks are the ones that offer the best coverage of translation initiation rate space, 1 being the optimal Bacillus RBS and 7 being the weakest.

Source

Synthetic

igem#sampleStatus In stock  
igem#status Available  
synbiohub#ownedBy user/james  
synbiohub#ownedBy user/myers  
synbiohub#topLevel BBa_K1351029/1