Source:
Generated By: https://synbiohub.org/public/igem/igem2sbol/1
Created by: Cyprien Maisonnier
Date created: 2008-08-11 11:00:00
Date modified: 2015-05-08 01:10:02
Promoter of flgB gene from E. coli flagella
| Types | DnaRegion |
| Roles | promoter Regulatory |
| Sequences | BBa_K136002_sequence (Version 1) |
Description
flgB is a class 2 gene that is part of the construction of the flagella ( Ordering Genes in a Flagella Pathway by Analysis of Expression Kinetics from Living Bacteria - S. Kalir, J. McClure, K. Pabbaraju, C. Southward, M. Ronen, S. Leibler, M. G. Surette, U. Alon ).Its promoter is consitutively repressed.
It is activated by FlhD4C2 and maybe by FliA with different strength ( Using a Quantitative Blueprint to Reprogram the Dynamics of the Flagella Gene Network - Shiraz Kalir and Uri Alon ).
Work in progress : Deeper quantitative characterization
Notes
The primers used to amplify this sequence are :*Forward :
GTTTCTTCGAATTCGCGGCCGCTTCTAGAGACAGTATCGCGATGATCGCCACGCTACG
*Reverse :
GTTTCTTCCTGCAGCGGCCGCTACTAGTAAGCATATCTCCTCCGCAGGTATCAAAATT
Source
This part comes from the genome of E.coli K12 strain MG1655.| Sequence Annotation | Location | Component / Role(s) |
| FlhDC Binding site 1 FlhDC Binding site 2 Initiation of Transcription | 98,113 124,139 173,173 | non_covalent_binding_site feature/binding non_covalent_binding_site feature/binding sequence_feature feature/misc |