Source:
Generated By: https://synbiohub.org/public/igem/igem2sbol/1
Created by: Gaurav Sinsinbar,Nikhil Patidar ,Chandel Angad Singh
Date created: 2014-10-09 11:00:00
Date modified: 2015-05-08 01:10:15
sqr gene (sulfide quinone reductase) and cysI gene (sulfur reductase) under constitutive promoter
| Types | DnaRegion |
| Roles | Composite engineered_region |
| Sequences | BBa_K1395003_sequence (Version 1) |
Description
This part is composite biobrick having parts of biobricks Bba_K896000 and Bba_K896001. The first part is sqr gene obtained from biobrick Bba_K896000. In this part the gene is expressed under a constitutive promoter and this enzyme converts the sulphide (S-2 ) to elemental Sulfur. And the second part is cysI gene obtained from Bba_K896001 which converts sulphite(SO32-) to sulphide (S-2 ) . So, these two parts codes for proteins which simultaneously work to convert sulphite (SO32-)to elemental Sulfur.Notes
Cys1 gene have restriction site for EcoR1 and Pst1 and therefore was not compatible for 3A assembly. To clone this part using 3 assembly we amplify the part using primers containing site for different restriction enzyme but having same flanking sequences. Cys1 gene was our part B in the 3A assembly, so it was to be restricted digested by Xba1 and Pst1. Hence, we designed primers such that at rear end part had a site of Nsi1 which has same flanking sequence as that of Pst1. Now this PCR amplified part was restriction digested with Nsi1 and Xba1. pSB1C3 (plasmid backbone) was digested with EcoR1 and Pst1. Then both parts were ligated with backbone using 3A assembly.Cys1-FP:: ATGTCTAGAGAGGAGGAAAAAAATGTACGTATACGACGAG
Cys1-RP:: CCAATGCATCCTGCAGCGGCCGCTACTATATTAATGATTC
We designed this Biobrick as mentioned we had used a constitutive promoter Bba_J23119 (member of Anderson family). This promoter consists the RBS itself. This was succeeded by part for sqr gene (Bba_K896000) . Then we were constrained to apply any RFC10 further so we designed primers for Cys1 which also contains commonly used RBS Sequence (Shine Dalgarno Sequence).
Source
Basically this Biobrick is a composite part which is created by two genes regulated by same constitutive promoter. This is made up of parts which we got from biobricks Bba_K896000 and Bba_K896001. Out of these Biobricks Bba_K896000 encodes sulfide quinone reductase (Source Synechococcus sp. PCC 7002) and Bba_K896001 encodes sulfite reductase, Cys1 (Source:Pseudomonas aeruginosa strain PAO1).| Sequence Annotation | Location | Component / Role(s) |
| BBa_J23119 start K896000 stop BBa_K896000 start misc stop BBa_K896001 Shine Dalgarno Sequence | 1,35 42,44 42,1322 1320,1322 42,1322 1343,1345 1329,2987 2999,3001 1343,3001 1331,1342 | engineered_region feature/BioBrick start_codon feature/start feature/misc sequence_feature stop_codon feature/stop engineered_region feature/BioBrick feature/start start_codon sequence_feature feature/misc stop_codon feature/stop feature/BioBrick engineered_region feature/rbs ribosome_entry_site |