Source:
Generated By: https://synbiohub.org/public/igem/igem2sbol/1
Created by: Isabelle Capell-Hattam
Date created: 2015-08-24 11:00:00
Date modified: 2015-08-25 02:16:32
TGV Pseudoknot
| Types | DnaRegion |
| Roles | mature_transcript_region RNA |
| Sequences | BBa_K1677743_sequence (Version 1) |
Description
This is part of the BABS iGEM pseudoknot suite. This pseudoknot can be used for delayed translation of a protein sequence, by slowing the ribosome.Notes
All start codons had to be removed from the pseudoknot.20 base pairs from the viral DNA flank either side of the pseudoknot region.
3' flanking sequence ATCAAAGTTATTTAAACGAG
5' flanking sequence TTTGACATCTACAACAAAGA
The actual pseudoknot is:
UGCGGGGUUCUAGUGCAGCUCGACUAGAACCCUGCAUUGGUACUGAUCCAGACCAAGUUAGUAGAGCU
((((((((((((((..[[[[[.))))))))))))))(((((.(((...)))))))).......]]]]]
Estimated free energy: -33.47 kcal/mol
Source
Transmissible gastroenteritis virus| Sequence Annotation | Location | Component / Role(s) |
| 3' Flanking Region 5' Flanking Region TGV Pseudoknot | 1,20 88,108 20,88 | sequence_feature feature/misc feature/misc sequence_feature feature/tag tag |